shRNA Adeno-associated Virus Serotype 2, p7SK-(Gpatch2-shRNA-Seq5)(CAT#: AAV-SI3529WQ)

This product is a Gpatch2-shRNA encoding AAV, which is based on AAV-2 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gpatch2-shRNA-Seq5
Related Target/Protein Gpatch2
Region 3UTR
TargetSeq CGCCAGTGATAGAAATGGGAT
NCBI RefSeq NM_026367
Alternative Names Pfa1; CT110; GPATC2; PPP1R30
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 55105
Uniprot ID Q9NW75

Related Products

Advertisement