shRNA Adeno-associated Virus Serotype 2, p7SK-(Gsdma3-shRNA-Seq1)(CAT#: AAV-SI4029WQ)
This product is a Gsdma3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Gsdma3-shRNA-Seq1 |
Related Target/Protein | Gsdma3 |
Region | CDS |
TargetSeq | GCTCTGACAGAGCTAACTGAA |
NCBI RefSeq | NM_001007461 |
Alternative Names | Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l |
Titer | >1*10^10 GC/mL |