shRNA Adeno-associated Virus Serotype 2, p7SK-(HOOK2-shRNA-Seq2)(CAT#: AAV-SI3318WQ)
This product is a HOOK2-shRNA encoding AAV, which is based on AAV-2 serotype. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | HOOK2-shRNA-Seq2 |
Related Target/Protein | HOOK2 |
Region | CDS |
TargetSeq | GCTATTTGAATGCCGCAACCT |
NCBI RefSeq | NM_013312 |
Alternative Names | HK2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity and type 2 diabetes |