shRNA Adeno-associated Virus Serotype 2, p7SK-(Izumo4-shRNA-Seq1)(CAT#: AAV-SI4005WQ)

This product is a Izumo4-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Izumo4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Izumo4-shRNA-Seq1
Related Target/Protein Izumo4
Region CDS
TargetSeq GCTTTGGCTACTACTGCAAGT
NCBI RefSeq NM_027829
Alternative Names C19orf36; IMAGE:4215339
Titer >1*10^10 GC/mL
Target Gene
Gene ID 113177
Uniprot ID Q1ZYL8

Related Products

Inquiry Now
Advertisement