shRNA Adeno-associated Virus Serotype 2, p7SK-(KLHL7-shRNA-Seq1)(CAT#: AAV-SI1064WQ)

This product is a KLHL7-shRNA encoding AAV, which is based on AAV-2 serotype. The KLHL7 encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. The expression of KLHL7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KLHL7-shRNA-Seq1
Related Target/Protein KLHL7
Region 3UTR
TargetSeq CGCAGTATCTTAGCTCTAGAT
NCBI RefSeq NM_018846
Alternative Names CISS3; KLHL6; SBBI26
Titer >1*10^10 GC/mL
Related Diseases Retinitis pigmentosa
Target Gene
Gene ID 55975
Uniprot ID Q8IXQ5

Related Products