shRNA Adeno-associated Virus Serotype 2, p7SK-(LOC286238-shRNA-Seq1)(CAT#: AAV-SI1083WQ)
This product is a LOC286238-shRNA encoding AAV, which is based on AAV-2 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LOC286238-shRNA-Seq1 |
Related Target/Protein | LOC286238 |
Region | CDS |
TargetSeq | CAGCAAGGAATAGCAGTGAAA |
NCBI RefSeq | XM_379684 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cardiovascular disease (CVD) |