shRNA Adeno-associated Virus Serotype 2, p7SK-(LOC392563-shRNA-Seq1)(CAT#: AAV-SI3264WQ)

This product is a LOC392563-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LOC392563-shRNA-Seq1
Related Target/Protein LOC392563
Region CDS
TargetSeq CCGCGGTATTTCGTGGAATAA
NCBI RefSeq XM_373382
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative diseases

Related Products