shRNA Adeno-associated Virus Serotype 2, p7SK-(LSM14B-shRNA-Seq4)(CAT#: AAV-SI1424WQ)

This product is a LSM14B-shRNA encoding AAV, which is based on AAV-2 serotype. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LSM14B-shRNA-Seq4
Related Target/Protein LSM14B
Region CDS
TargetSeq CTTTGATTTCGAGAGTGCAAA
NCBI RefSeq NM_144703
Alternative Names FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3
Expression
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 149986
Uniprot ID Q9BX40

Related Products

Advertisement