shRNA Adeno-associated Virus Serotype 2, p7SK-(Lypd1-shRNA-Seq1)(CAT#: AAV-SI3976WQ)
This product is a Lypd1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Lypd1-shRNA-Seq1 |
Related Target/Protein | Lypd1 |
Region | CDS |
TargetSeq | CAGAAAGAAGTGATGGAGCAA |
NCBI RefSeq | NM_145100 |
Alternative Names | PHTS; LYPDC1 |
Titer | >1*10^10 GC/mL |