shRNA Adeno-associated Virus Serotype 2, p7SK-(MRPS26-shRNA-Seq1)(CAT#: AAV-SI1402WQ)
This product is a MRPS26-shRNA encoding AAV, which is based on AAV-2 serotype. Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. The expression of MRPS26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MRPS26-shRNA-Seq1 |
Related Target/Protein | MRPS26 |
Region | CDS |
TargetSeq | CAAGATCGAGCGAGTGAACAT |
NCBI RefSeq | NM_030811 |
Alternative Names | GI008; MRPS13; RPMS13; MRP-S13; MRP-S26; NY-BR-87; C20orf193; dJ534B8.3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |