shRNA Adeno-associated Virus Serotype 2, p7SK-(N4bp2-shRNA-Seq1)(CAT#: AAV-SI3623WQ)

This product is a N4bp2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert N4bp2-shRNA-Seq1
Related Target/Protein N4bp2
Region CDS
TargetSeq CTGATGACTACTTCTATATAA
NCBI RefSeq NM_001024917
Alternative Names B3BP
Titer >1*10^10 GC/mL
Related Diseases B-cell leukemia/lymphoma
Target Gene
Gene ID 55728
Uniprot ID Q86UW6

Related Products

Inquiry Now
Advertisement