shRNA Adeno-associated Virus Serotype 2, p7SK-(NCRNA00207-shRNA-Seq1)(CAT#: AAV-SI1331WQ)

This product is a NCRNA00207-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of NCRNA00207-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert NCRNA00207-shRNA-Seq1
Related Target/Protein NCRNA00207
Region CDS
TargetSeq GCTTGGGATCCAATCACTGAA
NCBI RefSeq NM_001012986
Alternative Names LINC00207
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388910

Related Products

Advertisement