shRNA Adeno-associated Virus Serotype 2, p7SK-(Obfc1-shRNA-Seq1)(CAT#: AAV-SI4050WQ)

This product is a Obfc1-shRNA encoding AAV, which is based on AAV-2 serotype. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Obfc1-shRNA-Seq1
Related Target/Protein Obfc1
Region CDS
TargetSeq GCAGCAGAAGATCTACCACAT
NCBI RefSeq NM_175360
Alternative Names AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79991
Uniprot ID Q9H668

Related Products

Inquiry Now
Advertisement