shRNA Adeno-associated Virus Serotype 2, p7SK-(Olfr1065-shRNA-Seq3)(CAT#: AAV-SI3769WQ)

This product is a Olfr1065-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr1065 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1065-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr1065-shRNA-Seq3
Related Target/Protein Olfr1065
Region CDS
TargetSeq CCCAAATCCAGTCATTCCTTT
NCBI RefSeq NM_146408
Alternative Names MOR190-1
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258403
Uniprot ID Q7TR70

Related Products