shRNA Adeno-associated Virus Serotype 2, p7SK-(OR2A5-shRNA-Seq4)(CAT#: AAV-SI3258WQ)

This product is a OR2A5-shRNA encoding AAV, which is based on AAV-2 serotype. The OR2A5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR2A5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR2A5-shRNA-Seq4
Related Target/Protein OR2A5
Region CDS
TargetSeq CCCATGAAATCAACCACTTCT
NCBI RefSeq XM_374683
Alternative Names OR2A8; OR2A26; OR2A11P; OR7-138; OR7-141
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 393046
Uniprot ID Q96R48

Related Products

Advertisement