shRNA Adeno-associated Virus Serotype 2, p7SK-(PCMTD1-shRNA-Seq2)(CAT#: AAV-SI1078WQ)
This product is a PCMTD1-shRNA encoding AAV, which is based on AAV-2 serotype. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PCMTD1-shRNA-Seq2 |
Related Target/Protein | PCMTD1 |
Region | 3UTR |
TargetSeq | GCTCCAGTAATTCCACAACAT |
NCBI RefSeq | NM_052937 |
Titer | >1*10^10 GC/mL |
Related Diseases | Glaucoma, Lung cancer |