shRNA Adeno-associated Virus Serotype 2, p7SK-(Pgm2-shRNA-Seq1)(CAT#: AAV-SI3932WQ)

This product is a Pgm2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Pgm2 gene catalyzes the conversion of the nucleoside breakdown products ribose-1-phosphate and deoxyribose-1-phosphate to the corresponding 5-phosphopentoses and has low glucose 1,6-bisphosphate synthase activity. The expression of Pgm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pgm2-shRNA-Seq1
Related Target/Protein Pgm2
Region CDS
TargetSeq CGGAACTTCTTTACCAGGTAT
NCBI RefSeq NM_028132
Alternative Names MSTP006
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55276
Uniprot ID Q96G03

Related Products

Advertisement