shRNA Adeno-associated Virus Serotype 2, p7SK-(PRM2-shRNA-Seq1)(CAT#: AAV-SI1397WQ)

This product is a PRM2-shRNA encoding AAV, which is based on AAV-2 serotype. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRM2-shRNA-Seq1
Related Target/Protein PRM2
Region CDS
TargetSeq GCAGAACCAGGAAGAGAACAT
NCBI RefSeq NM_002762
Alternative Names CT94.2
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 5620
Uniprot ID P04554

Related Products

Advertisement