shRNA Adeno-associated Virus Serotype 2, p7SK-(Prr13-shRNA-Seq1)(CAT#: AAV-SI4013WQ)

This product is a Prr13-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Prr13 gene may negatively regulate TSP1 expression at the level of transcription. The expression of Prr13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Prr13-shRNA-Seq1
Related Target/Protein Prr13
Region CDS
TargetSeq GAAGTCGCACAAGCATCACAA
NCBI RefSeq NM_025385
Alternative Names TXR1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54458
Uniprot ID Q9NZ81

Related Products

Advertisement