shRNA Adeno-associated Virus Serotype 2, p7SK-(S1pr4-shRNA-Seq1)(CAT#: AAV-SI4023WQ)
This product is a S1pr4-shRNA encoding AAV, which is based on AAV-2 serotype. The S1pr4 gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. The expression of S1pr4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | S1pr4-shRNA-Seq1 |
Related Target/Protein | S1pr4 |
Region | CDS |
TargetSeq | CTCATTGTCCTGCACTACAAT |
NCBI RefSeq | NM_010102 |
Alternative Names | EDG6; LPC1; S1P4; SLP4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lymphoma |