shRNA Adeno-associated Virus Serotype 2, p7SK-(SELRC1-shRNA-Seq2)(CAT#: AAV-SI1308WQ)

This product is a SELRC1-shRNA encoding AAV, which is based on AAV-2 serotype. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SELRC1-shRNA-Seq2
Related Target/Protein SELRC1
Region CDS
TargetSeq GTGTGAGAAGCCTGGAAAGAA
NCBI RefSeq NM_023077
Alternative Names RESA1; SCAN3; COA7; C1orf163
Titer >1*10^10 GC/mL
Related Diseases Respiratory disease
Target Gene
Gene ID 65260
Uniprot ID Q96BR5

Related Products