shRNA Adeno-associated Virus Serotype 2, p7SK-(SELRC1-shRNA-Seq2)(CAT#: AAV-SI1308WQ)
This product is a SELRC1-shRNA encoding AAV, which is based on AAV-2 serotype. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SELRC1-shRNA-Seq2 |
Related Target/Protein | SELRC1 |
Region | CDS |
TargetSeq | GTGTGAGAAGCCTGGAAAGAA |
NCBI RefSeq | NM_023077 |
Alternative Names | RESA1; SCAN3; COA7; C1orf163 |
Titer | >1*10^10 GC/mL |
Related Diseases | Respiratory disease |