shRNA Adeno-associated Virus Serotype 2, p7SK-(SERINC5-shRNA-Seq1)(CAT#: AAV-SI1498WQ)
This product is a SERINC5-shRNA encoding AAV, which is based on AAV-2 serotype. The SERINC5 gene impairs the penetration of the viral particle into the cytoplasm and enhances the incorporation of serine into phosphatidylserine and sphingolipids. May play a role in providing serine molecules for the formation of myelin glycosphingolipids in oligodendrocytes. The expression of SERINC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SERINC5-shRNA-Seq1 |
Related Target/Protein | SERINC5 |
Region | CDS |
TargetSeq | CACCGTCTACATCTACTCCTA |
NCBI RefSeq | NM_178276 |
Alternative Names | TPO1; C5orf12 |
Titer | >1*10^10 GC/mL |
Related Diseases | HIV infection |