shRNA Adeno-associated Virus Serotype 2, p7SK-(SESN1-shRNA-Seq1)(CAT#: AAV-SI3459WQ)

This product is a SESN1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SESN1-shRNA-Seq1
Related Target/Protein SESN1
Region 3UTR
TargetSeq GCAAAGAATGGGACTTGGATA
NCBI RefSeq NM_014454
Alternative Names PA26; SEST1
Titer >1*10^10 GC/mL
Related Diseases DNA damage
Target Gene
Gene ID 27244
Uniprot ID Q9Y6P5

Related Products

Inquiry Now
Advertisement