shRNA Adeno-associated Virus Serotype 2, p7SK-(SPACA7-shRNA-Seq1)(CAT#: AAV-SI1096WQ)

This product is a SPACA7-shRNA encoding AAV, which is based on AAV-2 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPACA7-shRNA-Seq1
Related Target/Protein SPACA7
Region CDS
TargetSeq GCGATCCTTCTGAGAATTATC
NCBI RefSeq NM_145248
Alternative Names C13orf28
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 122258
Uniprot ID Q96KW9

Related Products

Advertisement