shRNA Adeno-associated Virus Serotype 2, p7SK-(Svs3a-shRNA-Seq1)(CAT#: AAV-SI3951WQ)

This product is a Svs3a-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Svs3a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Svs3a-shRNA-Seq1
Related Target/Protein Svs3a
Region CDS
TargetSeq GAAGACATAGTTTGTGAAGAA
NCBI RefSeq NM_021363
Alternative Names Svp3; Svs3; Semg2; Svp-3; BB121242; 9530026M05Rik
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 64335
Uniprot ID F2Z472

Related Products

Advertisement