shRNA Adeno-associated Virus Serotype 2, p7SK-(TEX13B-shRNA-Seq1)(CAT#: AAV-SI1271WQ)
This product is a TEX13B-shRNA encoding AAV, which is based on AAV-2 serotype. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TEX13B-shRNA-Seq1 |
Related Target/Protein | TEX13B |
Region | CDS |
TargetSeq | CAGGTCAGTACAAACAGCCAT |
NCBI RefSeq | NM_031273 |
Alternative Names | TGC3B; TSGA5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Testis cancer |