shRNA Adeno-associated Virus Serotype 2, p7SK-(Tha1-shRNA-Seq1)(CAT#: AAV-SI3939WQ)
This product is a Tha1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tha1-shRNA-Seq1 |
Related Target/Protein | Tha1 |
Region | 3UTR |
TargetSeq | CTGGAGGATGGTGACATCATT |
NCBI RefSeq | NM_027919 |
Alternative Names | GLY1; 1300017K07Rik |
Titer | >1*10^10 GC/mL |