shRNA Adeno-associated Virus Serotype 2, p7SK-(THOC1-shRNA-Seq3)(CAT#: AAV-SI1033WQ)
This product is a THOC1-shRNA encoding AAV, which is based on AAV-2 serotype. THOC1, also known as HPR1, is part of the TREX (transcription/export) complex and participate in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. The expression of THOC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | THOC1-shRNA-Seq3 |
| Related Target/Protein | THOC1 |
| Region | CDS |
| TargetSeq | AGACTCAGAAATTAGGCAGAT |
| NCBI RefSeq | NM_005131 |
| Alternative Names | P84; HPR1; P84N5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer, Liver cancer, Breast cancer |
