shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM167B-shRNA-Seq1)(CAT#: AAV-SI3204WQ)

This product is a TMEM167B-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM167B-shRNA-Seq1
Related Target/Protein TMEM167B
Region CDS
TargetSeq GCAATTGCTTGTGTTGTAATG
NCBI RefSeq NM_020141
Alternative Names AD-020; C1orf119
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 56900
Uniprot ID Q9NRX6

Related Products

Advertisement