shRNA Adeno-associated Virus Serotype 2, p7SK-(TRABD-shRNA-Seq2)(CAT#: AAV-SI1251WQ)

This product is a TRABD-shRNA encoding AAV, which is based on AAV-2 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TRABD-shRNA-Seq2
Related Target/Protein TRABD
Region 3UTR
TargetSeq CCACCCAAATAAAGGATTATT
NCBI RefSeq NM_025204
Alternative Names LP6054; PP2447
Titer >1*10^10 GC/mL
Related Diseases Graves' Disease
Target Gene
Gene ID 80305
Uniprot ID Q9H4I3

Related Products