shRNA Adeno-associated Virus Serotype 2, p7SK-(Trmt1-shRNA-Seq5)(CAT#: AAV-SI3707WQ)
This product is a Trmt1-shRNA encoding AAV, which is based on AAV-2 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Trmt1-shRNA-Seq5 |
Related Target/Protein | Trmt1 |
Region | CDS |
TargetSeq | GTCTGAAAGCAGTCCAGCATT |
NCBI RefSeq | NM_198020 |
Alternative Names | TRM1; MRT68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive intellectual disorder (ARID) |