shRNA Adeno-associated Virus Serotype 2, p7SK-(TTC1-shRNA-Seq1)(CAT#: AAV-SI1146WQ)
This product is a TTC1-shRNA encoding AAV, which is based on AAV-2 serotype. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TTC1-shRNA-Seq1 |
Related Target/Protein | TTC1 |
Region | CDS |
TargetSeq | CGGCTCGTACTCCATCAATTT |
NCBI RefSeq | NM_003314 |
Alternative Names | TPR1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Medullary Thyroid Cancer |