shRNA Adeno-associated Virus Serotype 2, p7SK-(TTC18-shRNA-Seq1)(CAT#: AAV-SI1114WQ)
This product is a TTC18-shRNA encoding AAV, which is based on AAV-2 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TTC18-shRNA-Seq1 |
Related Target/Protein | TTC18 |
Region | CDS |
TargetSeq | CAAGAGTTCCTCTGGTCACTA |
NCBI RefSeq | NM_145170 |
Alternative Names | CFAP70 |
Titer | >1*10^10 GC/mL |
Related Diseases | Outer dynein arm (ODA) |