shRNA Adeno-associated Virus Serotype 2, p7SK-(WBP2NL-shRNA-Seq1)(CAT#: AAV-SI3605WQ)
This product is a WBP2NL-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by WBP2NL gene may promote meiotic resumption and pronuclear development during oocyte fertilization. The expression of WBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | WBP2NL-shRNA-Seq1 |
Related Target/Protein | WBP2NL |
Region | CDS |
TargetSeq | CCCGAGGATTTCCACTTAGAA |
NCBI RefSeq | NM_152613 |
Alternative Names | PAWP; GRAMD7 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |