shRNA Adeno-associated Virus Serotype 2, p7SK-(WBP2NL-shRNA-Seq1)(CAT#: AAV-SI3605WQ)

This product is a WBP2NL-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by WBP2NL gene may promote meiotic resumption and pronuclear development during oocyte fertilization. The expression of WBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert WBP2NL-shRNA-Seq1
Related Target/Protein WBP2NL
Region CDS
TargetSeq CCCGAGGATTTCCACTTAGAA
NCBI RefSeq NM_152613
Alternative Names PAWP; GRAMD7
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 164684
Uniprot ID Q6ICG8

Related Products