shRNA Adeno-associated Virus Serotype 2, p7SK-(YPEL3-shRNA-Seq3)(CAT#: AAV-SI1160WQ)
This product is a YPEL3-shRNA encoding AAV, which is based on AAV-2 serotype. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | YPEL3-shRNA-Seq3 |
| Related Target/Protein | YPEL3 |
| Region | CDS |
| TargetSeq | GAAGTACATCATTGAACTCAA |
| NCBI RefSeq | NM_031477 |
| Alternative Names | Ypel3; Suap |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary tumor |
