shRNA Adeno-associated Virus Serotype 2, p7SK-(ZDHHC15-shRNA-Seq1)(CAT#: AAV-SI3845WQ)

This product is a ZDHHC15-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by ZDHHC15 gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). The expression of ZDHHC15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZDHHC15-shRNA-Seq1
Related Target/Protein ZDHHC15
Region 3UTR
TargetSeq CCATCAAATACTTGCTGTGTA
NCBI RefSeq NM_144969
Alternative Names MRX91; DHHC15
Titer >1*10^10 GC/mL
Related Diseases Mental retardatio X-linked type 91 (MRX91)
Target Gene
Gene ID 158866
Uniprot ID Q96MV8

Related Products

Advertisement