shRNA Adeno-associated Virus Serotype 2, p7SK-(ZDHHC3-shRNA-Seq3)(CAT#: AAV-SI1471WQ)

This product is a ZDHHC3-shRNA encoding AAV, which is based on AAV-2 serotype. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZDHHC3-shRNA-Seq3
Related Target/Protein ZDHHC3
Region CDS
TargetSeq GTGGATGAACATGAAAGCCGT
NCBI RefSeq NM_016598
Alternative Names GODZ; DHHC3; DHHC-3; ZNF373
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 51304
Uniprot ID Q9NYG2

Related Products