shRNA Adeno-associated Virus Serotype 2, p7SK-(ZER1-shRNA-Seq1)(CAT#: AAV-SI3362WQ)

This product is a ZER1-shRNA encoding AAV, which is based on AAV-2 serotype. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZER1-shRNA-Seq1
Related Target/Protein ZER1
Region CDS
TargetSeq CATAGGAATATGCTAGGACTT
NCBI RefSeq NM_006336
Alternative Names ZYG; C9orf60; ZYG11BL
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10444
Uniprot ID Q7Z7L7

Related Products

Inquiry Now
Advertisement