shRNA Adeno-associated Virus Serotype 2, pH1-(4930447C04Rik-shRNA-Seq1)(CAT#: AAV-SI2712WQ)

This product is a 4930447C04Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 4930447C04Rik-shRNA-Seq1
Related Target/Protein 4930447C04Rik
Region CDS
TargetSeq GAACATTACTCTGCGGTAAAT
NCBI RefSeq NM_029444
Alternative Names Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75801
Uniprot ID B2RQE0

Related Products

Inquiry Now
Advertisement