shRNA Adeno-associated Virus Serotype 2, pH1-(ANKRD20A1-shRNA-Seq1)(CAT#: AAV-SI0701WQ)

This product is a ANKRD20A1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of ANKRD20A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ANKRD20A1-shRNA-Seq1
Related Target/Protein ANKRD20A1
Region CDS
TargetSeq CAGATTGATGTCTGTGACAAA
NCBI RefSeq NM_032250
Alternative Names ANKRD20A
Titer >1*10^10 GC/mL
Related Diseases Behçet's disease
Target Gene
Gene ID 84210
Uniprot ID Q5TYW2

Related Products

Advertisement