shRNA Adeno-associated Virus Serotype 2, pH1-(Ankrd34a-shRNA-Seq1)(CAT#: AAV-SI3147WQ)

This product is a ANKRD34-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of ANKRD34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ankrd34a-shRNA-Seq1
Related Target/Protein Ankrd34a
Region CDS
TargetSeq CAAGAAGACCAGGCAGTATCT
NCBI RefSeq NM_001024851
Alternative Names ANKRD34
Titer >1*10^10 GC/mL
Target Gene
Gene ID 284615
Uniprot ID Q69YU3

Related Products