shRNA Adeno-associated Virus Serotype 2, pH1-(Atat1-shRNA-Seq1)(CAT#: AAV-SI3176WQ)
This product is a Atat1-shRNA encoding AAV, which is based on AAV-2 serotype. The Atat1 gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. The expression of Atat1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Atat1-shRNA-Seq1 |
Related Target/Protein | Atat1 |
Region | CDS |
TargetSeq | CCCACAGGTGAACAACTTTGT |
NCBI RefSeq | NM_028476 |
Alternative Names | TAT; MEC17; C6orf134; Nbla00487; alpha-TAT; alpha-TAT1 |
Titer | >1*10^10 GC/mL |