shRNA Adeno-associated Virus Serotype 2, pH1-(Atxn7l1-shRNA-Seq5)(CAT#: AAV-SI2710WQ)

This product is a Atxn7l1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Atxn7l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Atxn7l1-shRNA-Seq5
Related Target/Protein Atxn7l1
Region CDS
TargetSeq CGAGAAGTTAGACTGTCAGTT
NCBI RefSeq NM_001033436
Alternative Names ATXN7L4
Titer >1*10^10 GC/mL
Target Gene
Gene ID 222255
Uniprot ID Q9ULK2

Related Products

Advertisement