shRNA Adeno-associated Virus Serotype 2, pH1-(AY358078-shRNA-Seq1)(CAT#: AAV-SI2649WQ)

This product is a AY358078-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of AY358078-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert AY358078-shRNA-Seq1
Related Target/Protein AY358078
Region CDS
TargetSeq GCATGATTTCTCAACTCTTAC
NCBI RefSeq NM_194347
Titer >1*10^10 GC/mL
Target Gene
Gene ID 278676
Uniprot ID Q6UY53

Related Products

Inquiry Now
Advertisement