shRNA Adeno-associated Virus Serotype 2, pH1-(BC049762-shRNA-Seq1)(CAT#: AAV-SI3080WQ)

This product is a BC049762-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BC049762-shRNA-Seq1
Related Target/Protein BC049762
Region CDS
TargetSeq CACTTTCTGTGTACCCTCAAA
NCBI RefSeq NM_177567
Alternative Names 4930503F14
Titer >1*10^10 GC/mL
Target Gene
Gene ID 193286
Uniprot ID A0A338P6D5

Related Products