shRNA Adeno-associated Virus Serotype 2, pH1-(Btla-shRNA-Seq1)(CAT#: AAV-SI2578WQ)
This product is a Btla-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Btla-shRNA-Seq1 |
Related Target/Protein | Btla |
Region | CDS |
TargetSeq | CTTCAGAACACCCACTAATAA |
NCBI RefSeq | NM_177584 |
Alternative Names | BTLA1; CD272 |
Titer | >1*10^10 GC/mL |
Related Diseases | Rheumatoid arthritis. |