shRNA Adeno-associated Virus Serotype 2, pH1-(C15orf57-shRNA-Seq2)(CAT#: AAV-SI0816WQ)

This product is a C15orf57-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C15orf57-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C15orf57-shRNA-Seq2
Related Target/Protein C15orf57
Region CDS
TargetSeq GAGTTCTTTGTGGATGGACTT
NCBI RefSeq NM_052849
Alternative Names CCDC32
Titer >1*10^10 GC/mL
Target Gene
Gene ID 90416
Uniprot ID Q9BV29

Related Products

Inquiry Now
Advertisement