shRNA Adeno-associated Virus Serotype 2, pH1-(C16orf62-shRNA-Seq1)(CAT#: AAV-SI0986WQ)

This product is a C16orf62-shRNA encoding AAV, which is based on AAV-2 serotype. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C16orf62-shRNA-Seq1
Related Target/Protein C16orf62
Region CDS
TargetSeq CCTGTTCTTGTGCAGTTGATT
NCBI RefSeq NM_020314
Alternative Names VPS35L
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 57020
Uniprot ID Q7Z3J2

Related Products