shRNA Adeno-associated Virus Serotype 2, pH1-(C3orf37-shRNA-Seq1)(CAT#: AAV-SI0906WQ)

This product is a C3orf37-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C3orf37-shRNA-Seq1
Related Target/Protein C3orf37
Region CDS
TargetSeq CTACCAACTGTCGTAGTGATA
NCBI RefSeq NM_020187
Alternative Names DC12; SRAPD1; HMCES
Titer >1*10^10 GC/mL
Related Diseases DNA demethylation
Target Gene
Gene ID 56941
Uniprot ID Q96FZ2

Related Products