shRNA Adeno-associated Virus Serotype 2, pH1-(CASC4-shRNA-Seq3)(CAT#: AAV-SI0619WQ)

This product is a CASC4-shRNA encoding AAV, which is based on AAV-2 serotype. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CASC4-shRNA-Seq3
Related Target/Protein CASC4
Region CDS
TargetSeq GCACAAGAAACAGATCGACCA
NCBI RefSeq NM_138423
Alternative Names H63
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancers, Breast cancer
Target Gene
Gene ID 113201
Uniprot ID Q6P4E1

Related Products

Advertisement